Ashleygarcia090817go Ashleygarcia090817go

Biology

Answered

write the code for RNA from this DNA STRAND :

AAAAAATTTTTTCCCGGGGTTTATATATC

Answer :

Homadison4go Homadison4go

Answer:

UUUUUUAAAAAAGGGCCCCAAAUAUAUAG

Explanation:

All you have to do is apply the same concept as DNA, but T (Thymine) is replaced with U (Uracil)

Answer Link

Go Teaching: Other Questions

Which Of The Following Would Be The Easiest To Move? А a 5-pound Ball On Grass B a 5-pound Ball On Ice с a 10-pound Ball On Grass D a 10-pound Ball On Ice

Name One Pair Of Complementary Angles. (1 Point) 16. Name One Pair Of Supplementary Angles. (1 Point) 17. Draw An Angle That Measures 95° And Label It BAD. (2 P

Read The Sentences. Oregon And California Joined The United States. Interest In A Transcontinental Railroad Increased. Which Sentence Combines The Two Sentences

Why Is It Often Necessary To Add Air To Your Car Tires During The Winter?

While Traveling To Europe, Phelan Exchanged 250 US Dollars For Euros. He Spent 150 Euros On His Trip. After Returning To The United States He Converts His Money

What Does FTTB Mean?

The Sum Of Two Positive Numbers Is 45. What Is The Maximum Product Of One Of Them And The Square Of The Other? 

How Does The Meat Eating Plant Attract Its Prey? A) Colorful Flowers B) Nice Aroma C) Broad Leaves D) Sweet Sap

Which Of The Following Refers To As Irregular-shaped Slab That Are Moving In slow Motion? A Asthenosphere B.Lithosphere C.Lithospheric Plate D Mesosphere

FDP HELP PLEASE THANK YOU SO MUCH

Could You Guys Help Me With This Question?

PLZZZ HELPPP What Is The Y-intercept Of The Line Graphed On The Grid? A) (0,3) B) (-2.5,0) C) (3,0) D) (0,-2.5)