Video4allgo Video4allgo

Biology

Answered

transcribe this strand of DNA 5' 3’ TACGCGCATTTCGCCATGAAGACATTTATTCTGCTTCTC into mRNA- and Amino acid-

Answer :

Addysenseheultgo Addysenseheultgo

Answer:

AUGCGCGUAAAGCGGUACUUCUGUAAAUAAGACGAAGAG

Explanation:

this is the complementary strand for the mRNA.

A=U

C=G

G=C

T=A

this is the key for any mRNA strand.

;)

Answer Link

Go Teaching: Other Questions

What Were Central Elements In The Lives Of Postemancipation Blacks In The Twenty Years Following The End Of The Civil War?

As Head Of The Committee, It Is Up To You To Implement The Decision. Based On Your Decision, Answer These Three Questions: Who Is Responsible For The Changes? W

6 3/4 3 1/2 + 3 3/4?

Which Line From Beowulf Makes The Most Use Of Alliteration, The Repetition Of Consonant Sounds At The Beginning Of Words

How Do The Gospels Demonstrate The Significance Of Jesus’ Ministry

Which Behavior By A Preschool Child Indicates To The Nurse That The Child Is In The Appropriate Stage Of Growth And Development?

A 1250 Kg Car Traveling At A Speed Of 25.0 M/s Rounds A 175 M Radius Curve. Assuming The Road Is Level, Determine The Coefficient Of Static Friction Between The

First Read: Comprehension Identify The Choice That Best Answers The Question. In "Dark They Were, And Golden-Eyed," What Is Mr. Bittering's First Clue That His

Six Times The Difference Of A Number And 2 Is 14

N What Ways Do You Believe The Importance Of The Declaration Of Independence Has Changed Since It Was Written?

You're Prepared To Make Monthly Payments Of $195, Beginning At The End Of This Month, into An Account That Pays 8 Percent Interest Compounded Monthly, How Many

Read The Following Statements. Statement 1: "If She Is Stuck In Traffic, Then She Is Late." Statement 2: "If She Is Late, Then She Is Stuck In Traffic." Stateme