Sxfeheavengo Sxfeheavengo

Biology

Answered

PLS HELP ME WITH THIS!!!

What is the nucleotide sequence of the mRNA strand you built?

Answer :

Haleyrabygo Haleyrabygo

Answer:

A DNA strand contains the following nucleotide sequence: TACTGCCTCCCCATAAGAATT

Explanation:

Answer Link

Sbliz2606go Sbliz2606go

Answer:

AUG CUG ACC UAG

Explanation

If this question is on the gizmo "RNA and Protein Synthesis" then this is the answer for that.

Answer Link

Go Teaching: Other Questions

The Box Plot Below Represents Some Data Set. What Percentage Of The Data Values Are Less than 32?

After Reviewing What You Planned To Discuss With The Rossis With A Classmate, What, If Any, Changes Did You Need To Make? If You Had To Make Changes, Were They

I REALLY NEED HELP WITH THIS QUESTION!!!! Jim Took Clothes To The Cleaners Three Times Last Month. First, He Brought 2 Shirts And 2 Pairs Of Slacks And Paid $1

The Population Of The City Of Peachwood Is Currently 12,000 And increases Every Year At A Rate Of 5%. The Function That Describes The model Is G(f) = 12000 1.05

For The Functions F(x)=2x3 And G(x)=3x3−2, Find (f∘g)(1) And (g∘f)(1).

Find The Sum Of 5v25 And V7 In Simplest Form.Also,determine Whether The Result Is Rational Or Irrational And Explain Your Answer

The Half-life Of Palladium-100 Is 4 Days. After 20 Days A Sample Of Palladium-100 Has Been Reduced To A Mass Of 3 Mg. What Was The Initial Mass (in Mg) Of The S

3. Carl Leaves Home On His Bicycle At 9:30am. His Sister, Karen, Who Can Ride 3 Mph Faster Than Carl, Leaves Home At 10:30am To Catch Up With Him. If They Use T

Hi Can Someone Solve This With Steps?

State All Integer Values Of X In The Interval-2≤ X ≤ 5 That Satisfy The Following inequality: 5x+9<7

Political Organizations That Advocate Policies That Benefit Most Citizens Are Called

Find The Circumference Of The Circle Use 3.14 R=6