Jrodisgo Jrodisgo

Mathematics

Answered

Simplify: -12 • -4

Giving Brainliest^^

A) -4,816
B) -16
C) 16
D) 48

Answer :

59palak10go 59palak10go

Answer:

The right answer is option (d) 48.

Answer Link

Apajsgo Apajsgo

Answer:

It be D my dudette

Step-by-step explanation:

Answer Link

Go Teaching: Other Questions

Riana Notices Her Two-year Old Daughter Putting Sand In Her Mouth On The Beach. Though Riana Tried To Stop Her, The Baby Didn’t Stop. What Do You Think Riana Sh

I Music At The Art Museum Is Divided Into Six Sections That Each Contain About The Same Number Of Tiles There Are 2889 Tails Total In The Music About How Many T

The Trip From Carville To Planesborough Takes 4 Hours When Traveling At A Constant Speed Of 70 Miles Per Hour. 2 1 How Long, In Hours, Does The Trip Take When T

How Can Mutations Occur In Cells? Submi Save And Exit Next Mark This And Return

Tyler Was Too Tired To Concentrate On The Difficult Questions. If You Wanted To Include The Phrase, "after Studying All Night For The Big Exam," Which Would Be

Simplify:(-3x3)(-2x) A. -5x15 B 6x15 –5x² 6x

Rewrite As A Simplified Fraction. 0.23 With .23 Repeating

Which Type Of Climate Daon Why The Reasons:you Prefer To Live

According To MLA, When You Use An Author's Ideas In Your Paper, You Must Give Credit To That Author. This Is Done By Writing Parentheses After The Quote. What M

Write The Code For RNA From This DNA STRAND : AAAAAATTTTTTCCCGGGGTTTATATATC

Read The Following And Answer The Question. Which Of The Following Questions Is Most Likely Answered In This Excerpt? Ortega Knew He Had To Find The Owner Of Th

PLEASE HELP!! A Local Little League Has A Total Of 85 Players, Of Whom 40% Are Right-handed. How Many right-handed Players Are There? There Are Right-handed Pla