SnigdhaV660500go SnigdhaV660500go

Biology

Answered

Which of the following would provide the first codon?mRNA: UUCAAUGCCUCAAGGUUAAAGCGGCGGUUCCCUGGCAUG

Answer :

RosaleighB446534go RosaleighB446534go

Cells decode mRNAs by reading their nucleotides in groups of three, called codons.

-One "start" codon, AUG, marks the beginning of a protein and also encodes the amino acid methionine

UUCAAUGCCUCAAGGUUAAAGCGGCGG

So the first codon would be AUG

Answer Link

Go Teaching: Other Questions

Determine Whether Each Relation Is A Function. Explain. a. (-4, 4), (-3, 3), (-2, 2), (-1, 3), (0, 4) Yes Each impar SOLUTION a. Every Input Has Exactly One Out

The _pronouns_ Used When People Or Things Exchange An Action Are Called _

3. The Following Graph Shows Taylor's Journey Home. The Y-axis Is The Distance Taylor Is From Home. The X-axis Shows The Time Of His Journey. According To The G

How Much Energy Does A Wave With A Frequency Of 3.78 X 10¹0 Hz Have?

Benjamín Decide Desayunar En Su Restaurante Favorito. Ordena Una Leche Con Chocolate, Que Cuesta \$3.25$3.25dollar Sign, 3, Point, 25. Luego, Quiere Comprar Tan

Determine The Value Of X. A) 12 /3 B) 6/3 C) 2 /3 D) 12

The Diameters Of Bolts Produced In A Machine Shop Are Normally Distributed With A Mean Of 5.18 Millimeters And A Standard Deviation Of 0.07 Millimeters. Find Th

Except For The Battle Of Glorieta Pass, The Confederates Won The Encounters In New Mexico. What Factors May Have Contributed To This?

A Park Has Grass And Sand. Find The Area Of The Part With Grass. (Sides Meet At Right Angles.) 5 M 2 M 3 M 2 M ↓ 3 M sand grass 7 M 2 M 5 M

On A Final Exam, Each Multiple-choice Question Is Worth 4 Points And Each Word Problem Is Worth 8 Points. Lorenzo Needs At Least 50 Points On The Final To Earn

What Is The Reflection Over The Y Axis (-6,0)

Do You Think Political Parties Have Too Much Or Too Little Influence Over The Legislative And Executive Branch?Give Two Reasons Why Or Why Not. Explain You Usin